Godlike Productions - Conspiracy Forum
Users Online Now: 2,185 (Who's On?)Visitors Today: 2,028,515
Pageviews Today: 2,668,943Threads Today: 578Posts Today: 11,932
08:04 PM

Rate this Thread

Absolute BS Crap Reasonable Nice Amazing


User ID: 100150
05/30/2006 08:14 PM
Report Abusive Post
Report Copyright Violation
I need to review. I’ve said Genesis 3, Apocalipsis 12:9; Numbers 21:8, 9; Isaiah 6:1-6; 14:29; 30:6 hide the secret of interdimensional seraphim which is “hanashash” bright spiritual 6-winged snake having feet and hands. The fact once it didn’t crawl suggest it had feet and I even set the dense and flesh and blood fossil of the snake with feet which is the material matrix.
[link to groups.msn.com]

Dragons looked like dinosaurs (tanninim is the Hebrew word for those big monsters) in that earthy fossil record. The shape applies even using Tesla Coil copper devices in pyramids, the Rainbow Snake bursts out as a form of double helix.
[link to www.keelynet.com]

[link to www.subtlenergies.com]

[link to www.newscientist.com]

Yet we can see with electromicrography the chromosomes do have loops like “wings” in DNA.
[link to www.grahamhancock.com]

Read all these 7 pages.

We are aware there are also 2 serpents of energy climbing up and down the spine from the gonads to the brain (ida & pingala) which are wrapped in the sexual organs and even do a “hissing” sound when lifted up. Christ compared himself lifted up at the cross with Moses’ copper snake “nahash nehoshet”. Since in the Book of Dead the Egyptians depicted Isis helpers using scepters with a single snake –not Caduceus- that could mean the moment chromosomes split from the parents to beget the child …in this case Horus. They also depicted snakes with feathers (Toth and Quetzalcoatl) close to the Ank cross as a symbol of life and death key which is the same thing we read about Christ in Apocalipsis. Egyptians used blue lily and opium (imported from Greece) and cocaine and nicotine (from Peru?) and the Mayans used mescalito, mushroom and chocolate and Inkas the Ayahuasca or San Pedro cactus, etc to enhance the power of the 3rd eye or pineal gland. Not only that but in Apocalipsis 11:8 says Christ was symbolically crucified in Sodomah and Egypt (symbol of flesh and corruption?).

The fact is the sacred chambers were usually built with stones that were polished to optical degree and with no separation or junctions between them suggests a double purpose (if not more), a laboratory to be kept in darkness and to create a short circuit of the whole temple because they preferred copper rather than iron. Laboratories. Hieroglyphs with 2 D designs became “alive” in these chambers under the proper conditions. These painting in the film The Ten Commandments was based upon real hieroglyph that looks like Egyptian version of a seraphim but with just a pair of wings instead of 3 pairs:

[link to fotolog.terra.com.ar]

[link to fusionanomaly.net]

[link to www.grahamhancock.com]

The other thing that helped that meta-internet plug-in device within the brain better than Johnny Mnemotic was the deformation of the skulls. EINSTEIN’s brain helps us to understand better:

The size of his brain was not different from the average (1375 g). His parietal lobes at the upper part of the skull were 15% bigger than average and uncommonly symmetric on both hemispheres (responsible for computing visual data, math concepts elaboration and movement understanding). Normally deep central (Silvian sulcus) division of temporal lobe responsible for listening & speaking from frontal and parietal lobes almost didn’t exist in Einstein’s brain. There was no obstacle for nerve cells to create extensive connections between lobes and to build inside brain cortex of highly integrated net. Muchrooms also act with specific neurons and open consciousness “insight” other dimensions. Pressure of boards on Mayans, Incas and Egyptians’ babies’ forehead, occipital and parietal bones, resulted in growth of pressed brain cortex within deformed skull backwards. Parietal lobes developed freely and the pressed mass of neurons, the sulcus (fissure) between lobes disappeared making possible creation of additional connections. The net of neurons was bigger & complicated and the “antenna” (studied by English biologist, Rupert Sheldrake) gained bigger capacity of tuning to broader range of subtle signals. That was introduced to Mayans by the Olmecas but was practiced in other cultures as I am saying. So, there were these 2 elements (hallucinogenic plug-in and deformed skulls altering the brain) that created a whole nest of proto-Einsteins so to speak!

Chinese ideograms teach us the word “covet” was a woman staring the fruit of a couple of trees and Assyrians also carved monuments with the tree and the cherubim (eagle-man entities in fact is just one out of 4 faces of the cherubim) guarding it and pineal fruit. 2 Corinthians 11:3 admits Eve’s mind was altered by the snake and deceived.

[link to fotolog.terra.com.mx]

[link to www.hiddenmeanings.com]

That was also the legend mentioned by the Mayans. Lord Kingsborough says: "The Toltecs had paintings of a garden, with a single tree standing in the midst; round the root of the tree is entwined a serpent, whose head appearing above the foliage displays the face of a woman. Torquemada admits the existence of this tradition among them, and agrees with the Indian historians, who affirm that this was the first woman in the world, who bore children, and from whom all mankind are descended." ("Mexican Antiquities," vol. viii., p. 19.) There is also a legend of Suchiquecal, who disobediently gathered roses from a tree, and thereby disgraced and injured herself and all her posterity. ("Mexican Antiquities," vol. vi., p. 401.) Pandora’s attitude reflects the same thing. She coveted the fruit and unleashed Pandemonium hell and she was made of clay and her husband Epimetheus had a name meaning “who thought after” (the consequence of her attitude…like Adam).

Scientists have quadruplicated lifespan of worms and flies. They managed to do so by altering insulin genes but in mammals they have to fix the sexual genes. Hence there’s a connection between melatonin (which is said increases lifespan of the mice) and the sexual organs. There’s a connection between the couple of trees in Genesis. In the holographic universe we live in, our holographic brain is hooked with that reality as admitted by some neurophysiologists. In the cosmos there’s a X number bits of entropy, that is pure information. One of these “codes” is Solfeggio musical tones Ut-Re-Mi-Fa-Sol-La used by Hebrew priests from Levi’s house in harmony with 6 days of creation. That’s the chanting of the 6-winged snake seraphim. Hence the interdimensional seraphim/dragon/snake is hooked on the double snake made of sugar DNA. The tones help the DNA to catch UV light and “fix” it in better harmony. Read Dr. Horowitz’ s book “Pirates of DNA”. That chorus was antiphonal and inspired Tibetan and Gregorian Benedict chants. That helps the emission and reception of electromagnetic energy and it was found DNA acts like a dragon spitting fire (light=photon) even dwelling in aquatic medium (cell).

[link to www.soulsofdistortion.nl]

Our forefathers gained access to the tree of illumination by force, by stealing and in doing so they failed because there’s no real freedom without knowing there are rules. Hence we lost immortality and were trapped in this 3D like hamsters spinning endlessly in the wheel inside the cage. It’s as if we were trapped in a piece of a broken mirror or kaleidoscopic reality. Genesis is about “origin” and Adam & Eve endogamy genetic history is genetic incest, she was taken out of the rib which has marrow that created blood. Rib itself has a lot of secrets of regeneration when is removed but the surgeon leaves the periostium and other amazing revelations:
[link to www.s8int.com]

[link to www.innovations-report.com]

[link to www.hon.ch]

[link to www.answersingenesis.org]

Adam himself admitted she was made using his very flesh and bone. Probably to avoid immunology reaction. Cain married his sister-wife Awan being himself cursed from the beginning and perhaps offspring of Samael/Satan himself. Eve admitted his conception was with the help of the lord but what lord or powerful god since God Himself was against the whole thing? Satan had sexual intercourse with Eve and later on that anti-natural abomination was repeated by the rebel Watchers who followed the seraphim converted into cherubim. Incest was the way used by ancient elite –forbidden to the mob- to preserve the divinity in the graal blood all because of that tantrism between the spiritual entity and the woman. That was the real sin considering the use of Hebrew word “yadha” meaning knowing by (sexual) experience and after the knowing was always conceived a child. The lineage is part of this game as is 2 snakes, one from Seth and other from Cain’s lineage.

In this very thing Jews have used hidden codes like the one changing letters and writing in reverse or switching orders. Isaiah for example wrote something misunderstood by people who laughed at him and thought he should’ve been a kindergarten teacher. But he was playing games using Assyrian codes (28:10-13; 29:10-12). That was “hatoom” or sealed. Secret (Deuteronomy 32:34) This includes to write the things backwards (Isaiah 41:22, 23) and also math games.

[link to www.geocities.com]

The 22 letters of Hebrew alphabet was the number of human chromosomes when Adam was “formed” (not created “barah”) before the second manipulation which added the sexual chromosomes X and Y. In the sequence of nucleotides a fragment of DNA can be ‘spelled’ CGTAGAATTCTGCGAACCTT… in chain of “words” having 3 letters, so A is hooked to T or C with G. RNA messenger spells chemically and biologically the 22 (same number) of aminoacids forming proteins and all life on earth. Different from the language of Akad, Hebrew does have 3 root-letters.

So, when dealing with tree of knowledge we can’t ignore the tree of everlasting life connected with it. It’s about ADAN’S DNA in eDeN also. I have said the whole lineage was playing games with the names in Genesis to hide the mother side who had sex with seraphim/dragon. In Enosh times God’s name was known says Genesis. I found particularly interesting the studies made by Dan Burisch, Ph. D in molecular biology, when studying molybdenum found in quartz (we know granite quartz was also used in Great Pyramid).

[link to spirals.eternite.com]

This is too long to read unless you print. There are some errors and perhaps you will notice only once the YHVH tetragrammaton is changed to IEVE unless is removed from the pics. Also Enki and Enli in Sumerian account sometimes are the same character hence we can’t trust too much. Yet there are important things even in the lies here. I personally chat with Stan Tenan who discovered the “manual” application of Hebrew alphabet but he was humble enough to admit the sound of Hebrew was not his study but other completely different thing linked to mathematics.
I told here already, Isaiah 19:18, 19 says God’s name was part of an oath spoken in the language of Canaan (Paleo-Hebrew) and that name was not Freemasons’ Jahbulon, or Christians Jehovah, Yehova, Yahveh, Yaweh, etc but IEVE. Now, I read Burisch also mentioned the same name in his writings and whoever reads will find and associated not only with 4 elements (earth-wind-fire-water) but with the letters of DNA (adenine-cytosine-guanine-tymine). It seems he discovered the Ganesha particle and witnessed the interdimensional reality of the cherubim with 4 faces in a single head.
[link to www.cyberspaceorbit.com]

That reminds me also Jim Hurtak’s experiences inside Great Pyramid with chants in Hebrew as a language of light inside the brain and his visions. The theomath code in the same text of Isaiah 19:18, 19 says the Hebrew sacred inches which is the height of Great Pyramid:

[link to greatpyramid.org]

Burisch has mentioned a Hindu mandala which is like Star of David but this is seen from 2D perspective.

[link to groups.msn.com]

If we see that in 3D it’s like an upside down pyramid within another, like this:

[link to fotolog.terra.com.br]

Considering there are crystal cells with pyramid shape in neocortex in brain I wonder what was disconnected in the tree of everlasting life. Burisch says we get old because it was removed 2 genes from chromosomes and one of them was controlling aging process; when cells are duplicated in the body they are compared to the parent cell, not a master pattern that would exist in the genes, so the duplicate is not exactly the same in time. Again copper snake maybe has some hidden additional secrets. Hemophilia problems in past maybe not due to INTERMARRYING but copper based blood systems (blue blood), hemoglobin and copper systems don’t mix…. African “Eve” according to geneticist Rebecca Cann perhaps only between 22.000 and 180.000 years old and even that date depends on whether she had just a single partner or more or depending on uniformitarianism dogma.
If the open eyes can see a glimpse of other dimensions it seems our bodies don’t go along with the mind. Something happened, we were unplugged and hence even though we reckon our lifespan is absurd and stupid giant turtle in Galapagos lives 150 or 200 years old while we live 70 if cancer don’t kill us first or a stroke in spite of all that intelligence, something is wacko and would be lunatic to assume God or mommy nature gave intelligence to someone living 70 and imbecility to a being living perhaps 250. Is like setting a motor of a motorcycle in a Boeing 707 while the engines of a plane are set in a motorcycle. That’s ridiculous and all inside us is shouting to reject that misery. We were disconnected from interdimensional reality.
Anonymous Coward
User ID: 100189
05/30/2006 10:26 PM
Report Abusive Post
Report Copyright Violation
Hey Zeus

User ID: 78926
United States
05/30/2006 10:29 PM
Report Abusive Post
Report Copyright Violation
i embedded the true answer to this question in another thread.
but 1st...
you must be willing to partake of the, so called, 'forbidden' fruit! (which is knowledge about good and evil)

I'm Working on a Mystery
Anonymous Coward
User ID: 100189
05/31/2006 12:02 AM
Report Abusive Post
Report Copyright Violation
Another day is upon us.

User ID: 92671
United States
05/31/2006 12:44 AM
Report Abusive Post
Report Copyright Violation
it was weed stoner

User ID: 92671
United States
05/31/2006 12:44 AM
Report Abusive Post
Report Copyright Violation

User ID: 92671
United States
05/31/2006 12:45 AM
Report Abusive Post
Report Copyright Violation
no i personally believe it was sex
Anonymous Coward
User ID: 100240
05/31/2006 01:53 AM
Report Abusive Post
Report Copyright Violation
Anonymous Coward
User ID: 12280
United States
05/31/2006 02:16 AM
Report Abusive Post
Report Copyright Violation
a nut tree, which when eaten by fruitarians would produce an immediate hard on for adam and get the juices flowing for eve. thats why they needed the fig leaves, they get really big, to cover up with.

User ID: 903
United States
05/31/2006 02:24 AM
Report Abusive Post
Report Copyright Violation
I think theres actually a religion called Fruitarians!

Alice in Jail
User ID: 91477
United States
05/31/2006 02:50 AM
Report Abusive Post
Report Copyright Violation
The Majik Mushrooms, Yehhhhhhhh
Wowwww, look at the pretty colors maaaan, Wooooow.
User ID: 100529
05/31/2006 06:20 PM
Report Abusive Post
Report Copyright Violation
The nudity was not placed in the mouth which bit or the hand that stole the fruit but in euphemistic hips which they covered and then the deity provided larger clothes. That "eat" was a symbol of sex indeed just like "knew" in sexual sense. Pain was added to pregnancy which is also the "fruit" of having sex...in this case illicit sex and "seed". Can't you see? If you were reading Dead Sea scrolls you won't read in Genesis 4:1 that Eve gained a child with the help of the Lord but "ADAM KNEW (SEX)HIS WIFE EVE WHO WAS PREGNANT BY SAMMAEL, AND SHE CONCEIVED AND BARE CAIN, AND HE WAS LIKE THE HEAVENLY BEINGS, AND SHE SAID 'I HAVE GOTTEN A MAN FROM THE ANGEL OF THE LORD". In 1 John 3:12 Cain who was OF that wicked one...according to Greek # 1537 Strong's Concordance means a SON OF or OFFSPRING which is the same thing we read in Wycliffe Bible Commenatry, volume 3, page 936 and Mathew Henry's Commentary, volume 6 page 1077.
Cain's lineage is still alive today and perhaps you wanna know the association with that traitor who exchanged communication during II W.W and being arrested because of this, his name Prescott Bush and his son George Bush Sr. who was ex-boss at CIA and president and ordered the formation of the NWO in America and his son Bush Jr. dubya bushfingwho is spying you right now checking this message. Perhaps you wanna read instead of jumping and wanna know who's the Black Pope Cain's lineage inside Vatican instead of the Pope and all Edom descents who are Khazar "Jews". Do you want to be aware of these things? Outta read from the beginning first:
[link to apollonius.net]
[link to www.sherryshriner.com]
[link to www.sherryshriner.com]
User ID: 103378
06/07/2006 01:22 PM
Report Abusive Post
Report Copyright Violation
On page 1 we read the story is Jewish lie and it was bad whatever is written. So far in these 5 pages it's been discussed is not only a story told by Jewish but appears in Greek myths, in Chinese language, in Assyrian carvings, in Meso-America Mayan tales and so on. Yet, what hasn't been discussed is why was forbidden. In one word : protection. When you have a baby child you warn him not to touch the fire or switch otherwise he/she can put his life into jeopardy. That's exactly what happened in the past. Men need to know the things by step by step procedure and with maturity,not by an act of stealing. They gained knowledge indeed but the cost was too much. Lifespan was dramatically reduced in few generations. Again that story is told in Mesopotamia and China, etc.
User ID: 103378
06/07/2006 01:26 PM
Report Abusive Post
Report Copyright Violation
Ooops! wasntme I wrote "it was bad whatever is written"... I mispelled, I wanted to say that we read is bad whatever is FORBIDDEN.
Anonymous Coward
User ID: 103391
06/07/2006 01:58 PM
Report Abusive Post
Report Copyright Violation
Anonymous Coward
User ID: 73941
United States
06/07/2006 02:14 PM
Report Abusive Post
Report Copyright Violation
"Yet, what hasn't been discussed is why was forbidden. In one word : protection. When you have a baby child you warn him not to touch the fire or switch otherwise he/she can put his life into jeopardy. That's exactly what happened in the past. Men need to know the things by step by step procedure and with maturity, not by an act of stealing."




reminds me how we're not to 'overload the motherboard'.

There's an ancient middle eastern curse that states, "May your kundalini rise and your karma clear all in one day!!"


if you have ANY idea what either of those do to the human psyche, mind, soul of a person you'll understand the 'curse' of it...

nothing should happen fast....no quick fixes.

slow and steady...
Anonymous Coward
User ID: 125974
United States
08/03/2006 06:33 AM
Report Abusive Post
Report Copyright Violation
The fruit was sex with Satan which produced a "bad seed" line...the line of Cain...and continues to this day.
 Quoting: Anonymous Coward 96386

and is generally known as women. Specifically old spinsters.
User ID: 126022
United States
08/03/2006 07:35 AM
Report Abusive Post
Report Copyright Violation
The fruit was sex with Satan which produced a "bad seed" line...the line of Cain...and continues to this day.
 Quoting: Anonymous Coward 96386

Actually Eve had adulterous sex with a watcher angel, who left his first estate, as YHVH"s guardian of Adam & Eve as well as the 'Garden of Eden'. After Satan tempted this watcher angel, who was manlike in form, to disobey YHVH and rebel, he became a Satan posessed fallen angel, called 'The Serpent'. Eve sinned, by willingly having sex with this Serpent, still in manlike form, until YHVH cursed him. She succumbed to Satan's temptation to have a god-man conceived in her womb. A reptillian hybrid, who was Cain, was the cross between human flesh and strange fallen angel flesh, that was so conceived in Eve's womb. The Tree of Life is YaoHuVeHshua, the living Torah. Eve, however partook of the Tree of the Knowledge of good and evil; the Kabballah, which is comprised of morality. The Kabballah has a morally good right side, called the Sephiroth. It also has a morally evil left side, called the Qliphoth. It's fruit turned Eve into a self righteous moral person, who saw not only Cain as a god-man in his own right, but Eve also began to see herself and Adam as god-persons, having become wise in themselves. Adam did not sin, but took the death penalty of Eve's sin upon his self, and became her sin and curse, as he foreshadowed YaoHuVeHshua, who was the second Adam, who removed the death penalty curse from Adam's seed race of people, who inheirited it from the first Adam, or proto-type man. As the reality of type substance, YaoHuVeHshua in doing so, became our death penalty curse, and being sinless, as the first Adam once was, restored everlasting redemption to the Adamic seed race of people, who were progenated through Adam and Eve's true human son Seth, since Cain murdered Abel before Abel could marry and sire children. YHVH spoke enmity between Adam's seed and the seed of the Serpent through Cain, and to the present day, the conflict still rages, but will soon be ended by YaoHuVeHshua, who; when he had died and spent three days and nights, in the place of the righteous dead [Sheol], reclaimed the keys of power and authority over mankind and the Earth from Satan, and his devils and their hybrid fleshclad seed persons, and returned them to Adam's seed people, who had forfeited them when Adam willingly handed them to Satan and his, in Eden !
Anonymous Coward
User ID: 118379
United States
08/03/2006 07:36 AM
Report Abusive Post
Report Copyright Violation
an olive.
Anonymous Coward
User ID: 126038
New Zealand
08/03/2006 07:37 AM
Report Abusive Post
Report Copyright Violation
knowledge of course ...
User ID: 126052
United States
08/03/2006 08:16 AM
Report Abusive Post
Report Copyright Violation
It is looking into the well of consciousness to see there is a great darkness within humanity. Once one has looked they must turn away or be consumed by it.
It is the path wev'e taken which is difficult but God gives us that free will. It is hard to cut ones children lose knowing they may or may not return.
Anonymous Coward
User ID: 85241
United States
08/03/2006 08:57 AM
Report Abusive Post
Report Copyright Violation
The forbidden fruit was...KNOWLEDGE.

User ID: 113430
08/03/2006 09:06 AM
Report Abusive Post
Report Copyright Violation
"The fruit Eve ate was in reality a mushroom type growth that the Elohim had not yet perfected for us and was actually a poison at that time."

[link to www.botany.hawaii.edu]
The Reptilian Elite are planning economic collapse, martial law and micro-chipping next year (2007).
Anonymous Coward
User ID: 126222
08/03/2006 04:23 PM
Report Abusive Post
Report Copyright Violation
Anonymous Coward
User ID: 771
United States
08/03/2006 04:43 PM
Report Abusive Post
Report Copyright Violation
Man 2.0

User ID: 123010
United States
08/03/2006 05:09 PM
Report Abusive Post
Report Copyright Violation
Mickey Martian

User ID: 54006
United States
08/03/2006 05:13 PM
Report Abusive Post
Report Copyright Violation
The forbidden fruit was the acquirement of true spiritual identity and knowledge as imparted by the "Serpent".

The Serpent was not a being, it was a sect among the "Divine" beings who were present on Earth at the time of the creation of Human Beings.

Two factions existed, basically, one that wanted to keep Human Beings spiritually dim, so that they would comply to servitude.

The other found the idea reprehensible, and conspired to teach Human Beings about their true potential.

The mystery here is who was the Villain? One might be tempted to cast the Serpent as the Hero here...but the Serpent really screwed things up for our species. The reason being there was one key element that goes along with spirituality...maturity.

"God" said that if Man took of the first tree, on that day he would surely die.

The Serpent said "...ye shall not surely die."

The crux is this: "God" knew that if Man acquired spiritual knowledge, he would punish them with death. A day to God is as 1000 years on Earth...so basically Adam and Eve died in a day as promised.

The serpent knew of the other tree, which was a tree of eternal life. "Ye shall not surely die....if you can get to the other tree." (I'm putting words into the text that do not exist for illustrative purposes.)

"God" prevented man from immortality and assured his promised death. Meanwhile, Mankind had spiritually awakened, revealing their shame at being "Naked" or being treated like beasts of burden.

Without Immortality, advanced spiritual concepts are all but impossible to obtain, particularly as the long lifespans of Mankind got bred out over the generations.

Furthermore, "God" cursed the ground and made it so Man would have to spend all of his day in toil and sweat to put food on the table.

The serpent is punished by being twisted into a compromised organization that no longer sponsers spiritual education but begins to erase spiritual knowledge from mankind.

Hope that helps.

 Quoting: Greg_B.

This is correct for the most part, except I don't believe spiritual immaturity justifies the spiritual deceit we've lived under for thousands of years. As for the serpent, I think the religious structure, whoever it may be, whether Christianity, Judaism, Islam, has always attempted to erase true spiritual knowledge from humanity in order to keep us under control. cheers.
Anonymous Coward
User ID: 126256
08/03/2006 05:47 PM
Report Abusive Post
Report Copyright Violation
Anonymous Coward
User ID: 112496
United States
08/03/2006 06:00 PM
Report Abusive Post
Report Copyright Violation
The forbidden fruit was knowledge of good and evil.

This caused us to see things around us as good and evil, even if they weren't.

It turned us against each other. And where we were blissful and happy before, we became judgemental, egotistical, shameful, greedy and so on.

It's all animalistic behaviour. If we can overcome those things we return to the garden of eden...which is actually right here on earth
Anonymous Coward
User ID: 117476
United States
08/03/2006 06:24 PM
Report Abusive Post
Report Copyright Violation
Polarity was born.
